Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Your guide to YASARA View



° 

Essentials

-

What you really have to know


° 

Selections

-

Tell YASARA what you want


° 

Commands

-

Tell YASARA what to do


° 

Recipes

-

Answer complex questions


° 

Macros

-

Automate your work with Yanaconda


° 

Plugins

-

Extend YASARA with your own functions


° 

Plugins allow you to add your own menu options

° 

Plugins can be written in Yanaconda or Python

° 

Python can be downloaded from www.python.org

° 

Plugins must stick to format conventions

° 

Plugins can access most YASARA functions

° 

Python plugins can access a number of predefined variables


° 

Object descriptors identify selected objects

° 

Molecule descriptors identify selected molecules

° 

Residue descriptors identify selected residues

° 

Atom descriptors identify selected atoms

° 

Python plugins run in a separate thread

° 

Plugins can be speeded up by switching off the console

° 

Plugins can be run from the command line and in console mode

° 

Debugging is done by adding temporary print commands


° 

Scripts

-

Use YASARA as a Python module


° 

Troubleshooting

-

Get things going