Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

PosText

-

Position and justify text


CommandArgument DatatypeDefaultMinMax
Format:PosTextX = Cursor X-position in Angstroms or percent,FLOAT ---
   Y = Cursor Y-position in Angstroms or percent,FLOAT---
  justify = Left | Center | RightSTRING---
Python:PosText(x,y,justify)
Menu:Effects > Text > Position
Related:Font, Print , MakeTextObj, PrintObj , PrintCon, PrintHUD
Required:


The PosText command places the cursor on the current text object or the HUD, and choses a justification mode for subsequent Printing.

When printing to an object, positions are best given in percent of the width (X) and height (Y) of the current text object . The coordinate system originates from the bottom left corner 0%/0% with the X-axis pointing right to 100%/0% and the Y-axis pointing up to 0%/100%. The given Y-position coincides with the baseline of the printed characters.

When printing to the HUD , positions must be given in column/row format. There are 40x38 characters available, position 1/1 is in the top left corner.

Example 1:
PosText 50%,50%,center

Position the cursor in the middle of the text object and print a centered text.


Example 2:
PosText 0%,100%,justify=left

Position the cursor in the top left corner of the text object and print a left-justified text.