Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Pos<Obj|All>

-

Set/get object or scene position


CommandArgumentDatatypeDefault Min Max
Format: Pos<Obj|All> Selection, SELECTION- - -
   X = X-Position in Å,FLOAT ---
   Y = Y-Position in Å, FLOAT-- -
   Z = Z-Position in Å FLOAT-- -
Python:Pos<Obj|All>(selection1,x,y,z)
resultlist = Pos<Obj|All>(selection1)
Menu:Effects > Position > Set/Get
Related:Move, AutoMove , AutoMoveTo, Ori , NiceOri, Rotate , AutoRotate, AutoRotateTo
Required:


The PosAll command sets or gets the position of the scene, PosObj does the same for individual objects.

Coordinates for PosAll and PosObj are given in YASARA's global coordinate system , where 0/0/0 is the window center, the Y-axis points upwards and the Z-axis points into the screen. The direction of the X-axis depends on the handedness of the coordinate system.

Example 1:
PosObj 1crn,2,-3,10

Set the origin (0/0/0) of the local coordinate system of object 1crn to position X=2,Y=-3,Z=10 in YASARA's global coordinate system .


Example 2:
PosAll 0,0,50

Set the rotation center of the entire scene to 0/0/50 in YASARA's global coordinate system.


Example 3:
PosObj 1crn,Y=5

Set the Y-coordinate of object 1crn's local coordinate system origin to 5 in YASARA's global coordinate system .


Example 4:
x,y,z = PosObj 1crn

Assign the current position of object 1crn to variables x,y and z.


Example 5:
pos() = PosObj 5

Assign the current position of object 5 to the list 'pos'.