Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Pos<Atom|Res|Mol>

-

Set/get atom positions


CommandArgument DatatypeDefaultMinMax
Format:Pos<Atom|Res|Mol> Selection, SELECTION- - -
   X = X-Position in Å,FLOAT ---
   Y = Y-Position in Å, FLOAT-- -
   Z = Z-Position in Å, FLOAT-- -
   CoordSys = local | global,STRINGlocal --
  Mean = Yes | NoSTRINGNo- -
Python:Pos<Atom|Res|Mol>(selection1,x,y,z,coordsys,mean)
resultlist = Pos<Atom|Res|Mol>(selection1)
Menu:Effects > Position > Set/Get
Related:Move
Required:


The PosAtom, PosRes and PosMol commands set or get the position of one or more units in the specified coordinate system.

In the majority of cases, the coordinates of interest are those in the local coordinate system of the object the atom belongs to, i.e. those shown in the atom property HUD and PDB files. If the CoordSys parameter is set to 'global', then the atom coordinates refer to YASARA's global coordinate system , where 0/0/0 is the window center, the Y-axis points upwards and the Z-axis points into the screen.

Results are normally returned per atom, unless the Mean parameter is set to 'yes', in which case the geometric center of the selected atoms is returned.

Example 1:
PosAtom 500,X=-10,Y=20,Z=30

Place atom 500 at position -10/20/30 in the object's local coordinate system.


Example 2:
PosAtom 600,0,0,0,CoordSys=global

Place atom 600 at position 0/0/0 in the global coordinate system (the center of the screen).


Example 3:
PosAtom Obj 1crn,Mean=Yes

Get the mean atom position in the local coordinate system of object 1crn, i.e. the geometric center.


Example 4:
PosAtom Obj 1crn,X=10,Y=8,Z=-3,Mean=Yes

Shift the atoms in object 1crn such that the mean position, i.e. the geometric center, gets the coordinates 10/8/-3.


Example 5:
PosAtom CA

Get the local positions of all Calpha atoms.


Example 6:
PosAtom 100,CoordSys=global

Get the position of atom 100 in the global coordinate system .


Example 7:
x,y,z = PosAtom 500

Assign the position of atom 500 in the object's local coordinate system to variables 'x','y' and 'z'.


Example 8:
x,y,z = PosRes Lys 50

Assign the position of the geometric center of residue Lys 50 to variables 'x','y' and 'z'.


Example 9:
pos() = PosAtom 600,CoordSys=global

Assign the current position of atom 600 in the global coordinate system to the list 'pos'.