Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

PointerStyle

-

Set style of mouse pointer


CommandArgument DatatypeDefaultMinMax
Format:PointerStyle Type = Normal | YASARASmall | YASARALargeSTRING ---
Python: PointerStyle(Type)
Menu:Options > Input devices
Related: MouseWheel
Required:


The PointerStyle command defines the appearance of the mouse pointer while it is on top of the YASARA window. Choosing a large mouse pointer is especially useful during a scientific presentation.

Example 1:
PointerStyle Normal

Choose the operating system's mouse pointer style.

Example 2:
PointerStyle YASARALarge

Choose YASARA's mouse pointer.