Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

PointPar

-

Set point and line radius and plasticity in wire frames


CommandArgument DatatypeDefaultMinMax
Format:PointParRadius = point radius in pixels, FLOAT-0.532.0
  plastic = Yes | NoSTRING - --
Python:PointPar(radius,plastic)
Menu:View > Points and lines
Related: StickRadius , BallRadius
Required:


The PointPar command defines the appearance of points and lines that are part of graphical objects like the electrostatic potential, some 3D tables, and most importantly: WHAT IF MolObjects created in the Twinset YASARA.

If 'plastic' points are disabled, the maximum point radius visible on screen depends on the OpenGL implementation and may be smaller than selected.

Example 1:
PointPar Radius=2,plastic=No

Draw plain points and lines that are always four pixels thick.


Example 2:
PointPar Radius=8,plastic=Yes

Draw plastic points and lines that are up to 16 pixels thick at the front and get thinner at the back.