Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

PlayMovie

-

Play back macro as a movie


CommandArgument DatatypeDefaultMinMax
Format:PlayMovie Filename = Movie filename,STRING ---
   Help = Yes | NoSTRINGNo - -
Python: This command is mainly for internal use. It is not available in Python.
Menu:Options > Macro & Movie > Play movie
Keys:<Ctrl>+<M>  -  Rerun the last movie
Related:PlayMacro, StopMacro , OnError, RequireVersion
Required:


The PlayMovie command plays back one of the movies in the yasara\mov directory.

General help for creating movies can be found in the recipes section .

Contrary to the simple PlayMacro command, PlayMovie reads in the header of the specified macro, checks that it is really a YASARA Movie and which version of YASARA is required. If the movie needs commands not present in your stage of YASARA, the movie is instead played by YASARA Movie, which supports all commands. The Help-flag is set to 0 or 1 and can be checked in the movie macro to display different messages. I.e. if 'Help' is set to 'Yes', the movie should display instructive messages.

Press <Ctrl>+<M> to rerun the last movie.

Example 1:
PlayMovie welcome

Play the macro mov/welcome/welcome.mcr as a movie, setting variable Help to 0.


Example 2:
PlayMovie welcome,Help=Yes

Play the macro mov/welcome/welcome.mcr as a movie, setting variable Help to 1.