Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

PlayMacro

-

Play back macro


CommandArgument DatatypeDefaultMinMax
Format:PlayMacro Filename = Macro filename,STRING ---
   LabelSTRING ---
Python: This command is mainly for internal use. It is not available in Python.
Menu:Options > Macro & Movie > Play macro
Keys:<Ctrl>+<M>  -  Rerun the last macro
<Esc>  -  Interrupt a running macro
<Pause> or <P>  -  Pause/continue all tasks, including the macro
Related:RecordMacro, StopMacro, MacroTarget , OnError, RequireVersion
Required:


The PlayMacro command lets YASARA execute specified macro.

Macros are a collection of YASARA commands, often augmented with control flow instructions from the Yanaconda macro language. Any text editor can be used to write or modify macros, as long as they are saved in plain text (ASCII) format.

Normally YASARA updates the screen after each command executed. This may slow down your macro considerably, so consider switching off the console.

Example 1:
PlayMacro MDSimulation

Load the macro MDSimulation.mcr or mcr/MDSimulation.mcr and play it.


Example 2:
PlayMacro MDSimulation,Analysis

As above, but start playing at the label named 'Analysis:'.