Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Possible final selection types are All, Obj, Mol, Res and Atom

You can use the selection types listed above to select All, Objects, Molecules, Residues and Atoms. If you use All , the selection expression is left out (so you start immediately with the argument). If you also leave out the final selection type, All is assumed.

Examples:

ColorAtom CA,Red
Color all Calpha atoms red
ColorRes Lys,Blue
Color all lysine residues blue
DelMol B
Delete all molecules named 'B'
SwitchObj 1crn,Off
Switch object named 1crn off (hide it completely)
ColorAll Green
Color everything green, selection expression is left out
Color Yellow
Color everything yellow, final selection type and selection expression are omitted