Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Python functions return either nothing, a single value or a list

In the Yanaconda macro language you can choose between a single return value and a list by appending parentheses to the variable name . This is obviously not possible in Python. Instead those functions that are guaranteed to never return more than one value simply return this value, while functions possibly returning more than one value always return a list.

Examples:


# This function never returns a result:
Clear()

# This function always returns a single result, the number of the object loaded:
obj = LoadYOb("crambin")

# This function may return many results (if the PDB file contains an NMR bundle with many MODELs)
objlist = LoadPDB("3gb1")
# Or if you know that the PDB file contains only a single MODEL/object (note the slice [0]):
obj = LoadPDB("1crn")[0]

To find out what exactly a function returns, simply check the prototype on the documentation page, e.g. LoadPDB and LoadYOb