Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Plugins can be run from the command line and in console mode

Plugins are normally linked to options in the user interface. Sometimes, it may be helpful to run a plugin directly. This is achieved with the RunPlugin command in connection with SavePLI :


# Save a PLugin Input (PLI) File containing a selection of Calpha atoms
# and the request 'MyRequest'
SavePLIAtom CA,MyRequest
# Run the plugin
RunPlugin MyPlugin.py

If no selections are required, the plugin can also be run from the command line:

yasara PathToMyPlugin/MyPlugin.py MyRequest

Without any selections, no graphical user interface is needed, and plugins can also be run in console mode:

yasara -con PathToMyPlugin/MyPlugin.py MyRequest

If you want to exit YASARA as soon as the plugin has finished, add this line to the end of the plugin:

yasara.Exit()