Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

P5

-

Set state of p5 data glove


CommandArgument DatatypeDefaultMinMax
Format:P5Mode = Off | On,STRING - --
  Alpha = Alpha blending factor in percent FLOAT100.00.0100.0
Python:P5(mode,alpha=None)
Menu:This command is mainly useful for macros. There is no menu entry.
Required:


The P5 command toggles input via the P5 data glove, a virtual reality device you could obtain from www.essentialreality.com , however the company has disappeared in the mean time. Only the Linux version of the P5 glove is supported by YASARA.

Example 1:
P5 On,Alpha=50

Activate P5 data glove, show gestures half transparent.


Example 2:
P5 On,Alpha=00

Activate P5 data glove, do not show gestures.


Example 3:
P5 Off

Deactivate P5 data glove.