Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Ori<Obj|All>

-

Set/get object or scene orientation


CommandArgumentDatatypeDefault Min Max
Format: Ori<Obj|All> Selection, SELECTION- - -
   Alpha = Alpha angle,FLOAT - --
  Beta = Beta angle, FLOAT---
  Gamma = Gamma angle FLOAT---
Python:Ori<Obj|All>(selection1,alpha,beta,gamma)
resultlist = Ori<Obj|All>(selection1)
Menu:Effects > Orientation > Set/Get
Related: NiceOri , Rotate, AutoRotate , AutoRotateTo, Pos , Move, AutoMove , AutoMoveTo
Required:


The Ori command sets or gets the orientation of the selected objects or the entire scene. The orientation of an object is obtained by placing it at the origin, so that the object's local coordinate system and YASARA's global coordinate system coincide. Then the object is rotated by Alpha degrees about the X-axis, then by Gamma degrees about the Z-axis and finally by Beta degrees about the Y-axis of YASARA's global coordinate system.

In addition to the orientation of individual objects, you can also set the orientation of the entire scene. In combination with the Position, this allows you to choose a certain view automatically, for example inside a macro. Note however that the scene orientation is often reset to 0/0/0 (e.g. if you load another structure or move one single object around). Therefore you must get and then set the scene orientation at the same spot in your macro, otherwise you may end up with an unexpected view.

Example 1:
OriObj 1crn,Alpha=180,Beta=20,Gamma=-30

Orient object 1crn with angles 180/20/-30.


Example 2:
alpha,beta,gamma = OriAll

Assign the orientation of the scene to variables alpha,beta and gamma.