Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Optimize<Res|Mol|Obj|All>

-

Optimize molecular geometry


CommandArgument DatatypeDefaultMinMax
Format:Optimize<Res|Mol|Obj|All> Selection,SELECTION - --
  Method = STRINGQM--
Python:resultlist = Optimize<Res|Mol|Obj|All>(selection1,method=None)
Menu:Edit > Optimize
Related: QuantumMechanics , FormEnergy, Regularize , Experiment
Required:


The Optimize command improves the molecular geometry of the selected atoms using various energy-based methods, the final energy is returned. Currently only one method is supported:

  • Method QM: This approach uses semi-empirical quantum mechanics to optimize the geometry, and can thus be applied to a limited number of atoms only. If YASARA is configured to work in vacuo (i.e. the pH model has been deactivated), the geometry optimization will also be done in vacuo, otherwise the COSMO implicit solvent model (Klamt A (1995) J. Phys. Chem. 99, 2224) will be applied. This is especially important for highly charged molecules, e.g. when optimizing the solution structure of ATP in vacuo, the four negative charges at the phosphates could abstract a proton from a sugar hydroxyl group.

Notes: Before performing the QM optimization, YASARA randomly moves every atom a tiny little bit. This prevents the optimizer from getting trapped in certain types of local minima, and is responsible for the unexpected behavior that a second optimization of the already optimized structure does not instantly converge. When implicit solvent is included via the COSMO model, the optimization takes longer and is more likely to get trapped in a local minimum.

Example 1:
OptimizeRes ATP

Use quantum mechanics to optimize the geometry of residue ATP.


Example 2:
energy = OptimizeObj Butanol

Optimize the object named 'Butanol' and assign the resulting formation energy to variable 'energy'.