Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

OptHyd<Obj|All>

-

Optimize hydrogen bonding network


CommandArgumentDatatypeDefault Min Max
Format: OptHyd<Obj|All> Object selectionSELECTION ---
Python: OptHyd<Obj|All>(selection1)
Menu:Edit > Add > hydrogens to: object & optimize
Related:AddHyd , DelHyd, Experiment , Clean
Required:


The OptHyd command first adds hydrogens to the selected objects , and then invokes WHAT IF's OPTHYD option to optimize the hydrogen bonding network. Side-chains of Asn, Gln and His residues will be flipped if that improves the network.

WHAT IF normally restricts the analysis to standard amino acid and DNA bases.

Ambiguous, pH dependent cases like protonation of Asp and Glu residues are handled via pKa prediction by 'Experiment Neutralize'.

If the OptHyd command takes a lot of time , this is caused by the presence of water molecules, which cause a lot of ambiguity. Deleting less important waters on the protein surfaces results in an enormous speedup.

It is usually helpful to clean a structure before optimizing the network , since this removes alternate atoms.

Example:
OptHydObj 1crn

Optimize hydrogen bonding network of object 1crn.