Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

OnError

-

Set error action


CommandArgument DatatypeDefaultMinMax
Format:OnErrorAction = Stop | Continue | Exit STRING- - -
Python: OnError(action)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:Exit, StopMacro
Required:


When an error occurs, YASARA normally stops a running macro to prevent it from working on wrong input data. YASARA macros that are submitted automatically, for example via the Python interface, usually end with an Exit command - which is then never reached. On a cluster (e.g. Models@Home) this is bad, as the job never terminates. Putting 'OnError Exit' as the first command in such a macro makes sure that YASARA always exits and the calling program can detect the error (via the exit code or simply because an expected output file was not created).

When playing an interactive movie, it is not wanted that YASARA stops the macro as soon as the user makes an error. 'OnError Continue' lets the macro continue normally. In this case, you may have to press the <Esc> key to stop the macro manually.

The OnError setting is automatically changed back to the default 'Stop' when a new macro is run.

Example 1:
OnError Stop

Stop the running macro if an error occurs, that is the default.


Example 2:
OnError Continue

Ignore errors and continue the macro.


Example 3:
OnError Exit

If an error occurs, exit YASARA immediately.