Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Oligomerize<Obj|All>

-

Oligomerize objects to generate the biologically active form


CommandArgument DatatypeDefaultMinMax
Format:Oligomerize<Obj|All> Object selection, SELECTION- - -
   Center = Yes | NoSTRING Yes --
Python:resultlist = Oligomerize<Obj|All>(selection1,center=None)
Menu:Edit > Oligomerize
Related: Duplicate , Crystallize
Required:


The Oligomerize command creates the biologically relevant oligomer of the selected object.

To save space, many PDB files contain only a single monomer even though a larger oligomer has been crystallized. These PDB files then specify the transformations required to create the complete olgomer in a special remark named 'REMARK 350'. This remark with the contained BIOMT transformations is interpreted by the Oligomerize command.

If REMARK 350 is not present in your PDB file, Oligomerize cannot help, and the only remaining option is to check the PQS database at http://pqs.ebi.ac.uk.

Example 1:
OligomerizeObj 3

Create the biologically relevant oligomer of object 3 using REMARK 350 in the PDB file and center the new object.


Example 2:
OligomerizeAll Center=No

Oligomerize all objects but do not center afterwards.


Example 3:
objlist() = OligomerizeObj 5

Oligomerize object 5 and assign the numbers of the objects (including the initially selected one) to 'objlist'.



Example macro:

# EXAMPLE Oligomerize
# Requires YASARA Model
Clear
LoadPDB 3crx
OligomerizeObj 3crx
Pos 0,0,128
Ori 17,91,0
Style Tube
SecStrPar TubeRadius=0.19
ColorMol Protein,Blue,Cyan
ShowAtom NucAcid SideChain
StickRadius 100

Figure: Result of the example macro above.