Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Occup<Atom|Res|Mol|Obj|All>

-

Set/get the occupancy


CommandArgument DatatypeDefaultMinMax
Format:Occup<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   value = Occupancy to setFLOAT - 0.0100.0
Python:Occup<Atom|Res|Mol|Obj|All>(selection1,value)
resultlist = Occup<Atom|Res|Mol|Obj|All>(selection1)
Menu: Edit > Renumber > Occupancy
Analyze > Occupancy
Related: BFactor , Prop, Color , ColorPar
Required:


The Occup command sets or gets the crystallographic occupancy value of the selected atoms. In PDB files, the occupancy is stored in the column immediately to the right of the cartesian atom coordinates.

When coloring by occupancy, a value of 0% corresponds to yellow, and a value of 100% to blue by default. Other color schemes can be defined with the ColorPar command.

An easy way to delete atoms with alternate locations and keep only those with the highest occupancy is provided by the Clean command.

Atoms with occupancy 0 remain fixed when using the CONCOORD plugin to sample conformational space.

Some programs read PDB files and expect special values in the occupancy or B-factor fields. An example is the .pqr format, which interprets the occupancy as the atom's charge and the B-factor as the atom's Van der Waals radius. The example macro below shows how to create such a PQR file:


id='1crn'
# Get the clean structure
Clear
LoadPDB (id)
Clean
# Use charges and Van der Waals radii of the Yamber2 force field
ForceField Yamber2
Sim Init
Console Off
# Assign new occupancies and B-factors
for i=1 to Atoms
  charge = ChargeAtom (i)
  OccupAtom (i),(charge)
  radius = RadiusAtom (i)
  BFactorAtom (i),(radius)
SavePDB 1,(id).pqr


Example 1:
OccupAtom 124

Get the occupancy of atom 124.


Example 2:
OccupMol A

Get the average occupancy of molecule A.


Example 3:
OccupRes Asp Glu

Get the average occupancies of all residues named Asp or Glu.


Example 4:
occupancy = OccupObj 3

Assign the average occupancy of object 3 to variable 'occupancy'.


Example 5:
occuplist() = OccupRes Obj 3

Assign the average occupancies of the residues in object 3 to the list 'occuplist'.


Example 6:
OccupAtom Sidechain,50%

Occupy all side-chain atoms with 50% (0.5 in the PDB file).