Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ObjectSelectionMenu

-

Add a menu allowing to select objects

This keyword adds a standard object selection menu, the selections are passed to the Python plugin via object descriptors. The specified text appears as the window header. Yanaconda plugins can currently not access these selections.

The jth object descriptor in the ith selection window can be accessed as yasara.selection[i].object[j] (see below).

Example:

MainMenu: Analyze
  PullDownMenu: _M_CSIS mutations
    ObjectSelectionMenu: Select objects to map mutations stored in the MCSIS
    Request: MapMutations