Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Object

-

a collection of molecules and additional items

An object consists of molecules and other items like labels or arrows. If you load a PDB file, you will get one object. If the PDB file contains multiple models (NMR structures), every model will become one object.

Objects can be moved around independently with the mouse. Starting with YASARA Model, you can freely split objects into multiple smaller objects, and join them again.

Objects can be 'active' or 'inactive'. Inactive objects are removed from the soup , they are neither displayed on screen nor do they participate in molecular dynamics simulations. The only command that works on inactive objects is 'AddObj' - which brings them back to life.

Note that many commands act on all the atoms within an object, instead of the complete object (including labels etc.).

Example:

ColorObj 1crn,red

will color all atoms in the object named 1crn red, but not any additional items like labels or arrows that are attached to the object.


RotateObj 1crn,Y=90

will rotate object 1crn by 90 degrees about the Y-axis, including all additional items.

How can you tell the difference? Take a look at the description of the command. If you find the command listed with an 'Atom' extension (like 'ColorAtom'), you know that it is an atom-only command.

Figure: An object - Crambin with arrows, labels, hydrogen bonds and a ribbon backbone.