Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

NumberInputMenu[1-6]

-

Add a menu allowing to input 1 to 6 numbers

This keyword adds a window with one to six number input boxes. In addition to the window header, you must specify a general explanation text and then one descriptor for each number input box. A number descriptor contains four elements, separated by commas: the title of the number box, the default value, the minimum allowed value and the maximum allowed value.

The content of the jth number input box in the ith selection window can be accessed by the Python plugin as yasara.selection[i].number[j] (see below).

Example for a window with one number input box:

MainMenu: Edit
  PullDownMenu after Build: Sample
    PopUpMenu: _O_bject
      ObjectSelectionMenu: Select protein to sample conformational space with CONCOORD
      NumberInputMenu1: Select ensemble size
        Text: Number of structures in the CONCOORD ensemble:
        Number: _S_tructures,10,1,98
      Request: SampleObj