Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

NiceOri<Obj|All>

-

Orient objects nicely


CommandArgument DatatypeDefaultMinMax
Format:NiceOri<Obj|All>Object selection SELECTION---
Python:NiceOri<Obj|All>(selection1)
Menu:Effects > Orientation > Set nicely for object
Related:Ori, Pos
Required:


The NiceOri command chooses a nice orientation for the selected objects or the entire scene.

The definition of 'nice' is as follows: First the covariance matrix of the atom coordinates is calculated, then the object is oriented such that the eigenvectors of the matrix coincide with the axes of YASARA's global coordinate system.

In other words: YASARA determines the major axes of an object and aligns them with the global coordinate system, e.g. a single alpha helix ends up parallel to the X-axis.

Example 1:
NiceOriAll

Choose a nice orientation for the scene.


Example 2:
NiceOriObj 1crn

Choose a nice orientation for object 1crn.