Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Name<Atom|Res|Seg|Mol|Obj>

-

Set/get names of objects, segments, molecules, residues and atoms


CommandArgument DatatypeDefaultMinMax
Format:Name<Atom|Res|Seg|Mol|Obj> Selection,SELECTION - --
  Name = New name STRING---
Python:Name<Atom|Res|Seg|Mol|Obj>(selection1,name)
resultlist = Name<Atom|Res|Seg|Mol|Obj>(selection1)
Menu: Edit > Name
Related:Number
Required:


The Name command sets or gets the names of the selected units.

Example 1:
NameObj 1crn,Crambin

Rename object 1crn to Crambin.


Example 2:
NameMol All,A

Rename all molecules to A.


Example 3:
NameMol A-Z,' '

Set all chain identifiers empty (space).


Example 4:
NameRes MSE,MET

Rename all seleno-methionines to MET.


Example 5:
NameSeg All,'    '

Set all segment identifiers empty (4 spaces).


Example 6:
NameAtom OT2,OXT

Rename all terminal oxygens OT2 to OXT.


Example 7:
name = NameObj 5

Assign the name of object 5 to variable 'name'.


Example 8:
reslist() = NameRes all

Assign all residue names to list 'reslist'.