Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

MoveMesh

-

Move polygon mesh


CommandArgument DatatypeDefaultMinMax
Format:MoveMesh Object selection, SELECTION- - -
   X = Step along X-axis in Å,FLOAT 0.0--
   Y = Step along Y-axis in Å,FLOAT0.0--
  Z = Step along Z-axis in ÅFLOAT0.0--
Python:MoveMesh(selection1,x=None,y=None,z=None)
Menu:Effects > Move > Polygon mesh
Related: MoveAtom , ShowSphere, ShowBox , ShowCone, MakeImageObj , MakeTextObj
Required:


The MoveMesh command translates the vertices of a polygon mesh in the local coordinate system. It thus complements the MoveObj command which translates objects in the global coordinate system, and works exactly like MoveAtom - just that it translates polygon vertices instead of atoms.

Examples of polygon meshes affected by MoveMesh :

MoveMesh has no influence on dynamically updated polygon meshes, like secondary structure or dynamic surfaces.

The main purpose of MoveMesh is to facilitate rotations about a point X/Y/Z that is not the origin of the local coordinate system, simply by translating the mesh such that point X/Y/Z ends up with coordinates 0/0/0.

Example:
MoveMesh Box,X=0.1,Y=-0.2,Z=0.5

Add 0.1/-0.2/0.5 to the positions of the vertices in the polygon mesh stored in object 'Box'.