Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Move<Atom|Res|Mol|Obj|All>

-

Move atoms, objects or scene


CommandArgumentDatatypeDefault Min Max
Format: Move<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   X = Step along X-axis in Å,FLOAT 0.0--
   Y = Step along Y-axis in Å,FLOAT0.0--
  Z = Step along Z-axis in ÅFLOAT0.0--
Python:Move<Atom|Res|Mol|Obj|All>(selection1,x=None,y=None,z=None)
Menu:Effects > Position > Move
Related: Pos , AutoMove, AutoMoveTo , Ori, Rotate , AutoRotate, AutoRotateTo , Transfer
Required:


When complete objects are selected, the object's position in the global coordinate system is shifted, so the individual atom positions do not change. In all other cases, the local coordinates of the atoms are shifted, so that you can move parts of an object around. In this case it helps to first transform the object, so that it is obvious in which direction to move. If you want to shift the local coordinates in one entire object, use MoveAtom Obj X, not MoveObj X.

Example 1:
MoveAll Z=0.7

Add 0.7 to Z-position of the entire scene in the global coordinate system .


Example 2:
MoveObj 1crn,X=0.1,Y=-0.2,Z=0.5

Add 0.1/-0.2/0.5 to position of object 1crn in the global coordinate system.


Example 3:
MoveMol C,X=5

Add 5 to the X-positions of all atoms in molecule C in the local coordinate system.


Example 4:
MoveAtom CA,1,2,3

Add 1/2/3 to the positions of all CA atoms in the local coordinate system.


Example 5:
MoveAtom Obj 1crn,X=0.1,Y=-0.2,Z=0.5

Add 0.1/-0.2/0.5 to positions of all atoms in object 1crn in the local coordinate system.