Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

MouseWheel

-

Assign command to mouse wheel


CommandArgumentDatatypeDefault Min Max
Format: MouseWheel Command = MarkNext | GrabNext | MoveXY | MoveZ | RotateZSTRING---
Python:This command is mainly for internal use. It is not available in Python.
Menu:Options > Input devices
Related: SpaceBallButton , PointerStyle
Required:


The MouseWheel command associates a certain function with the mouse wheel.

In Linux and Windows, the default is 'MarkNext' to cycle through the atoms.

In MacOSX, the default is 'MoveXY' to move horizontally and vertically. This two-dimensional movement requires a Macbook trackpad or a Mighty Mouse. Watch the 'Welcome' help movie for details.

Example 1:
MouseWheel MarkNext

Use the mouse wheel to mark the next atom.


Example 2:
MouseWheel GrabNext

Use the mouse wheel to grab the next object for movement.


Example 3:
MouseWheel MoveXY

Use the mouse wheel to move along the X- and Y-axes in MacOSX (requires two-dimensional wheel or trackpad).


Example 4:
MouseWheel MoveZ

Use the mouse wheel to move along the Z-axis.


Example 5:
MouseWheel RotateZ

Use the mouse wheel to rotate about the Z-axis.