Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Molecule

-

any continuous stretch of residues sharing the same molecule name

If you already worked with other programs, you may know YASARA's 'molecules' as 'chains'. The name 'molecule' was chosen due to its more convenient abbreviation 'Mol' and for consistency with the WHAT IF program.

Note that a YASARA molecule is not always the same as a chemist's molecule. If two molecules ('A' and 'B') are joined with a disulfide bridge, they are still two separate molecules for YASARA as long as their names differ. Also if your structure contains 500 waters, all with the same molecule (=chain) name, they will be treated together as one 'molecule'.

Figure: Part of the peptide chain of crambin, created with the BuildMol command.