Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Moving objects around

Shift Grab next object for movement/rotation (YASARA Model and above)
Ctrl+Shift Grab previous object for movement/rotation (YASARA Model and above)
LeftClick in the 'Name' column of the HUDGrab the selected object for movement/rotation (YASARA Model and above)
LeftButton+MouseMovement Rotate object or scene or move label
Ctrl+LeftButton+MouseMovement Rotate object or scene, centered on the marked atom
LeftButton+RightButton+MouseMovement Move object or scene along the X/Y-axes
MiddleButton+MouseMovement Move object or scene along the X/Y-axes
Cursor keys Move object or scene along the X/Y-axes
RightButton+MouseMovement Move object, scene or label along the Z-axis
1..9 Set speed of movements (not on numeric keypad)
Q,W,E,R,T,Y Move grabbed object or scene along the three axes (English keyboard)
Ctrl+1..9 Set speed of rotations (not on numeric keypad)
A,S,D,F,G,H Rotate grabbed object or scene about the three axes (English keyboard)
Z,X,C,V,B,N Start automatic rotation of grabbed object or scene about the three axes (English keyboard)
LeftClick on a label Mark label and move it around

If an object reacts strangely when moving it around , the reason is most likely that some atoms are incorrectly placed far away from the object's center, for example after reading atom coordinates from a corrupted file. This makes the object appear larger, requiring YASARA to slow down or block movements. Delete these atoms or use the keyboard instead of the mouse.

The help movie 'Working with YASARA' shows how to configure the MacBook TouchPad and the Apple MightyMouse to function optimally with YASARA. When configured as suggested, the following bindings are available:

Apple MacBook TouchPad :
Button+SingleFingerMovement Rotate object or scene or move label
Ctrl+Button+SingleFingerMovement Rotate object or scene, centered on the marked atom
DoubleFingerMovement Move object or scene along the X/Y-axes
Button+DoubleFingerMovement Move object, scene or label along the Z-axis

Apple MightyMouse:
LeftButton+MouseMovement Rotate object or scene or move label
Ctrl+LeftButton+MouseMovement Rotate object or scene, centered on the marked atom
SideButtons+MouseMovement Move object or scene along the X/Y-axes
ScrollBall Move object or scene along the X/Y-axes
RightButton+MouseMovement Move object, scene or label along the Z-axis