Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

MinStep

-

Set energy minimization step


CommandArgumentDatatypeDefault Min Max
Format: MinStep Size = Maximum stepsize during steepest descent minimization in ÅFLOAT - --
Python:MinStep(size)
Menu: Simulation > Temperature control > Parameters
Related: Temp , TempCtrl, AnnealSteps
Required:


The MinStep command sets the maximum distance an atom is allowed to move during each step of a steepest descent minimization.

If the simulation cell contains a lot of potential energy (e.g. huge atom overlaps), the standard time step is usually too large to simulate the system reliably, the numerical error accumulates, the simulation cell overheats and 'explodes'. A steepest descent minimization avoids this problem by automatically choosing very small time steps and keeping the temperature at 0K. It is more secure but much slower than a simulated annealing minimization and should be used for a few hundred steps to remove bumps when importing a new protein structure.

Example:
MinStep 0.05

Automatically choose the time step for each simulation substep so that the fastest atom moves 0.05 Angstroms in every substep.