Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Making floating assignments

To activate floating assignments for all hydrogen atoms, set floating= 'Element H' in nmr_setdefaults.mcr.

The technical details of floating assignments

When you assign two resonances (e.g. 1.5ppm and 1.6ppm) of which you know that they are HG1# and HG2# of a certain valine residue, but you do not know whether HG1# belongs to 1.5 or 1.6 ppm (and the same for HG2#), you can make a 'floating assignment' and leave the choice to YASARA. During the structure determination process, YASARA will then automatically pick the assignment that minimizes the restraint violations.

Since such an uncertainty in the assignment translates to an uncertainty in the atom positions, YASARA borrows the classical uncertainty indicator from X-ray crystallography - the B-factor - to handle floating assignments.

The procedure is as follows:

  • The default B-factor of atoms (e.g. a peptide chain built with BuildMol) is 0. If an assignment involves atoms with B-factor 0, it is assumed to be certain. Before you start a simulation with distance restraints or calculate violation energies, you tell YASARA which atoms to consider for floating assignments by setting their B-factors to 25. This is done automatically in the macro nmr_solve.mcr using the command 'BFactorAtom (floating),25'. If all atoms in an assignment have a B-factor > 0, this shows YASARA that some uncertainty is involved.

  • YASARA then analyzes all atoms with a B-factor > 0 (normally 25, see above) to find atoms or atom groups whose assignments could potentially be swapped to improve the fit to the restraints. This requires a) that the residue contains a second, chemically equivalent atom (group), b) that there is at least one restraint assigned to the atom (group), and c) that there are no other restraints assigned to a subset of the atom group (which would be a bug in the restraint file). Typical examples are the two hydrogens of methylene groups (CBeta of many amino acids etc.) and the two methyl groups of valine and leucine. The procedure does not rely on a priori knowledge about certain residues and will thus also work with unusual amino acids. YASARA sets the B-factors of all atoms identified as being part of floating assignments to 50.

  • During a simulation, or before calculating violation energies, YASARA analyzes the floating assignments to see if the fit can be improved by swapping the assignments (the percentage of assignments analyzed each simulation step can be influenced with the 'FloatGroups' parameter of the RestrainPar command). If the violation energy could be reduced by swapping the assignment, the B-factors of the involved atoms are set to 75.

Using the B-factor to encode the floating assignment status has a number of advantages:

B-factor Color Meaning
0 Blue Assignment is certain, this atom is not considered for floating assignments (the default)
25 Magenta This atom is allowed to be part of floating assignments (set by you)
50 Red This atom is permanently checked for floating assignments (set by YASARA)
75 Yellow This atom is part of a swapped assignment (set by YASARA)

  • The floating assignment status is also saved in PDB files (the B-factor is the number on the far right side).

  • YASARA's selection language can be used to restrict floating assignments to certain atom groups:


# Activate floating assignments...
# ...for all hydrogens
BFactorAtom Element H, 25
# ...for the methyl groups of Leu 18:
BFactorAtom HD? Res Leu 18, 25
# ...for all methylene groups:
BFactorAtom Element H with bond to Element C and with 1 bond angle to Element H, 25
# ...for all methyl groups:
BFactorAtom Element H with bond to Element C and with 2 bond angles to Element H, 25


# List atoms that are allowed to be part of floating assignments:
ListAtom BFactor>0
# List atoms that are permanently checked for floating assignments:
ListAtom BFactor>25
# List atoms that are part of swapped assignments:
ListAtom BFactor>50
# Save a list of atoms that are part of swapped assignments:
LogAs swapped.lst,append=No, ListAtom BFactor=75

Since the output of the above commands may be inconvenient to parse when YASARA is coupled to an automated assignment program like ARIA, the ListFloat command provides a compressed output:


# List all floating assignments in object 3gb1
ListFloatObj 3gb1
# List only the swapped floating assignments in object 3gb1
ListFloatObj 3gb1,Type=swapped
# Save the swapped assignments to disk
LogAs swapped.tbl,append=No, ListFloatObj 3gb1,Type=swapped

To pass information about many different floating assignments back to YASARA, simply collect them in a text file, e.g. 'floating.txt':


HG? Residue 65 Segment "   A"
HB? Residue 73 Segment "   B"

Read this file in the YASARA NMR macro, and activate floating assignments for the listed atom groups by setting their B-factors to 25:


for group in file floating.txt
  BFactorAtom (group),25

The similarity to XPLOR syntax can be maximized by replacing 'Residue' with 'resid' and 'Segment' with 'segid'.