Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Menu

-

Switch menu on/off


CommandArgument DatatypeDefaultMinMax
Format:MenuFlag = On | Off STRING---
Python:Menu(flag)
Menu: Window > Show menu
Related:SeqSelector, HUD, Console, FullScreen
Required:


The Menu command toggles the display of the top menu and bottom status bars. Switching them off is mainly helpful when using YASARA for multimedia presentations .

If the menu is gone, there are two ways to bring it back:

  • Right-click on the background to open a context menu and click 'Menu'.

  • Press <Space> to open the console and type 'Menu On'.

Example 1:
Menu Off

Do not show the top menu line and the bottom status line.


Example 2:
Menu On 

Show them again.