Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Macros can be speeded up by switching off the console

Normally YASARA executes each command issued by the macro just as if it had been created via the graphical user interface. This includes printing the command in the console and updating the graphics display. If the macro issues hundreds of YASARA commands, this approach may become too slow. In this case simply take full control of YASARA by switching off the console:


Console Off

YASARA will then only redraw the screen when the macro explicitly requests it via the Wait command. More details about this approach can be found here.