Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Movies can be imported from OpenOffice or PowerPoint

When preparing movies for a scientific presentation that may last several hours, writing everything from scratch in Yanaconda takes too long. An efficient solution is to prepare the slides in OpenOffice Impress or Microsoft Powerpoint, to convert them to a YASARA movie and to finally add animations on those slides that require them.

The procedure is as follows:

  • Create the slides in OpenOffice Impress and save them in the standard format of your OpenOffice version (e.g. *.sxi). To import a PowerPoint presentation (e.g. in *.ppt format), first open it in OpenOffice Impress, correct the little details that OpenOffice's import filter got wrong and save it also in OpenOffice standard format.

  • Start YASARA and click Options > Macro & Movie > Import movie, select the OpenOffice *.sxi file, then choose a name for your movie and the animation to change the slides. In addition to the default AlphaBlend, the following animation types are supported for entering the screen: fromLeft, fromRight, fromTop, fromBottom, Circle, Jump, BlendLeft, BlendRight, BlendTop, BlendBottom, Pop. Leaving the sceen can be done with either toLeft, toRight, toTop, toBottom, Circle, Drop, BlendLeft, BlendRight, BlendTop, BlendBottom or Pop.

  • YASARA then creates a new movie directory in yasara/mov/YourMovieName, runs OpenOffice to convert the slides to platform independent PNG images, closes OpenOffice, and creates a Yanaconda macro to show the slides with the requested transition animations. Due to a bug in the Windows version of OpenOffice, YASARA may hang right after the OpenOffice window has been closed. In this case, press <Ctrl>+<Alt>+<Del> to bring up the task manager and manually kill the process named 'soffice.exe'. Then the conversion can be completed.

  • Click Help > Play help movie and select your movie in the Multimedia section 6.99.

  • Finally, open the macro yasara/mov/YourMovieName/YourMovieName.mcr in a text editor and add molecular animations where you intended. You can also give each slide a clear name, so that you can easily jump to a certain part of your presentation when required by a question from the audience.