Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Matrices are two dimensional lists

The same concept holds for multidimensional lists, but care must be taken that the list indices do not interfere, best by separating them with an underscore '_':


for i=1 to 12
  for j=1 to 12
    wrongmatrix(i)(j)=i*j
    rightmatrix(i)_(j)=i*j

Why is the first matrix wrong? Simply because the matrix elements 1,12 and 11,2 (like several others) map to the same variable name: wrongmatrix112. The underscore makes sure that the indices stay separated: rightmatrix1_12 and rightmatrix11_2 are indeed different names.

If you know the number of columns and rows in advance, you can use leading zeroes to avoid the underscore:


for i=01 to 12
  for j=01 to 12
    rightmatrix(i)(j)=i*j

In the above case, rightmatrix0112 and rightmatrix1102 correctly map to different variable names.