Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Mass<Atom|Res|Mol|Obj|All>

-

Calculate mass


CommandArgument DatatypeDefaultMinMax
Format:Mass<Atom|Res|Mol|Obj|All> Selection SELECTION- - -
Python: resultlist = Mass<Atom|Res|Mol|Obj|All>(selection1)
Menu: Analyze > Mass of
Related:Volume , Radius
Required:


The Mass command sums up the atomic masses per selected unit and returns the result(s) in g/mol. Alternative names for this unit are 'Dalton' (Da) or 'unified atomic mass unit' (u).

Example 1:
MassAtom 513

Get the mass of atom 513 in g/mol.


Example 2:
MassRes Lys 15

Get the mass of residue Lys 15.


Example 3:
m = MassObj 1crn

Get the mass of object 1crn and assign the result to variable 'm'.


Example 4:
masslist() = MassRes Obj 1crn

Assign the masses of the residues in object 1crn to list 'masslist'.