Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Movies are stored in the yasara/mov directory

Go to the yasara/mov directory and create a subdirectory with the name of your movie. In this subdirectory, you must then store all the data needed by your movie, including the Yanaconda macro (named like your movie, but with a .mcr extension).

As a start, open the macro yasara/mov/mdintro/mdintro.mcr, an introduction to molecular dynamics simulations. If you do not have this movie, download it from www.yasara.org/movies .

Change the header to match your movie. The chapter numbers in the TOPIC and TITLE fields define where your movie appears when you click on Help > Play help movie.

Example:

# YASARA MOVIE
# TOPIC:    6. NMR Spectroscopy
# TITLE:    6.4. KING - Killing Inaccurate NOEs by Guessing
# REQUIRES: Dynamics
# AUTHOR:   MyName
# LICENSE:  GPL