Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

MarkAtom

-

Mark atom with fireflies


CommandArgument DatatypeDefaultMinMax
Format 1:MarkAtom Atom selection,SELECTION - --
  Atom selection, SELECTION---
  Atom selection, SELECTION---
  Atom selection SELECTION---
Format 2: MarkAtom NoneSTRING - --
Python:resultlist = MarkAtom(selection1,selection2,selection3,selection4)
resultlist = MarkAtomNone()
Menu:Edit > Effects > Mark atom
Related:Label , ZoomAtom
Required:


The MarkAtom command marks up to four selected atoms with white, red, green and blue rotating fireflies. As a result, the HUD displays the white-red distance, the white-green-red angle and the white-blue-green-red dihedral.

If the first selection is 'None', all marks will be removed.

If no selection is made, the command returns the numbers of the four selected atoms. If less than four atoms are selected, the remaining return values are 0.

Example 1:
MarkAtom CA Res 17

Mark CA atom of residue 17.


Example 2:
MarkAtom None

Remove the flashing mark again.


Example 3:
MarkAtom 10,89,200,400

Put a white mark on atom 10, a red mark on 89, green on 200 and blue on 400.


Example 4:
a1,a2,a3,a4 = MarkAtom

Assign the numbers of the currently marked atoms to variables a1, a2, a3 and a4. If an atom is not marked, the value 0 is assigned.