Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

MakeTab

-

Make a table


CommandArgument DatatypeDefaultMinMax
Format:MakeTabName = Table name,STRING - --
  Dimensions = Number of table dimensions,INT1 1 3
   Columns = Number of table columns, INTAny - -
   Rows = Number of table rows, INTAny--
   Pages = Number of table pages INTAny--
Python: result = MakeTab(name,dimensions=None,columns=None,rows=None,pages=None)
Menu:Options > Table > Make
Related: Tab , Tabulate, SelectTab , MakeTab, ShowTab , LoadTab, SaveTab , FlipTab
Required:


The MakeTab command creates a table of the specified dimensions.

  • If a size is specified for each dimension (Columns,Rows,Pages), YASARA creates a table of fixed size, with all cells set to zero. This table can be modified using the Tab command.

  • If a size is specified for all but the last dimension, YASARA creates an empty table that grows while cells are added with Tabulate. This table is automatically selected for use by the Tabulate command. Added cells can also be modified using the Tab command.

If the Tabulate command is used without making a table before, an empty one dimensional table with name 'Default' is created automatically.

Example 1:
MakeTab Default

Create a one-dimensional table with name 'Default'. This table is initially empty and grows indefinitely while you add more cells to it.


Example 2:
MakeTab Name=RMSDMatrix,Dimensions=2,Columns=30,Rows=30

Create a two-dimensional table named 'RMSDMatrix', with a fixed size of 30x30 cells, initialized to zero. You cannot add any more cells to this table, but you can change table cells .


Example 3:
MakeTab Name=Results,Dimensions=2,Columns=10

Create a two-dimensional table named 'Results', with a fixed width of 10 columns but undefined height. This table is initially empty and grows indefinitely while you add more cells to it.


Example 4:
tab = MakeTab Density,Dimensions=3,Columns=20,Rows=25,Pages=30

Create a three-dimensional table named 'Density', with a fixed size of 20x25x30 table cells, initialized to zero. The number of the table is assigned to variable 'tab'. You cannot add any more cells to this table, but you can change table cells.