Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

MakeImageObj

-

Make object with attached image


CommandArgumentDatatypeDefault Min Max
Format: MakeImageObj Name = Object name,STRING ---
   Image selection,SELECTION ---
   Width = Board width in Å, FLOAT-- -
   Height = Board height in ÅFLOAT---
Python:result = MakeImageObj(name,selection1,width,height)
Menu:View > Image > Make object
Related: LoadBMP , LoadPNG, MoveMesh , MakeTextObj, ShowImage , AutoMoveImage, AnimateImage , SwapImage, HideImage , DelImage
Required:


The MakeImageObj command creates a rectangular polygon of the specified width and height, and attaches the selected image to it. The image must have been loaded before using LoadBMP or LoadPNG .

Note that the image itself is not saved as part of the scene , so when you load a scene containing an image object, you additionally have to load the image.

The created images rotates around the origin of its local coordinate system , which is at the center of the image. Use the MoveMesh command to shift the origin.

Example 1:
MakeImageObj Title,2,80,40

Create an object named Title, 80x40 Angstroms large and attach image 2 to it.


Example 2:
obj = MakeImageObj Wall,3,width=50,height=50

Create an object named Wall, 50x50 Angstroms large, attach image 3 to it and assign the object number to variable 'obj'.



Example macro:

# EXAMPLE MakeImageObj
# Requires YASARA Model
Clear
LoadBMP ysrbkgr1
for i=1 to 8
  MakeImageObj bg(i),ysrbkgr1,(20+i*2),(20+i*2)
  RotateObj (i),Z=(i*10)
  RotateObj (i),X=(i*10)
  AutoRotateObj (i),Y=(0.25*i)

Figure: Result of the example macro above.