Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

MacroTarget

-

Set macro target


CommandArgument DatatypeDefaultMinMax
Format:MacroTarget Filename = Filename of the structure to be used by macros STRING-- -
Python:This command is mainly for internal use. It is not available in Python.
Menu:Options > Macro & Movie > Set target
Related: PlayMacro
Required:


The MacroTarget command chooses a target to which a macro should be applied.

The filename specified by MacroTarget is stored without its file extension in the variable 'MacroTarget', which can be accessed by YANACONDA macros to determine the requested working directory and basename.

Example:
MacroTarget pdb/1crn.pdb

From now on, apply all macros to protein pdb/1crn.pdb (macros must use the MacroTarget variable).