Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Longrange

-

Set long range interactions


CommandArgument DatatypeDefaultMinMax
Format:Longrange Type = None | Coulomb STRING- - -
Python: Longrange(Type)
Menu:Simulation > Force field
Related: ForceField , Interactions, Cutoff , ScaleForce, SimSpeed
Required:


The LongRange command defines the treatment of long-range electrostatic interactions.

Long-range Coulomb interactions are calculated using the Particle Mesh Ewald (PME) algorithm, which requires a simulation cell with periodic boundary conditions. All YAMBER force fields are optimized for use with long-range Coulomb forces. The accuracy of the PME calculations can be influenced with the SimSpeed command.

The PME algorithm requires that the net charge of the atoms in the simulation cell is zero. This is normally achieved by adding counter ions to the system using the Neutralization Experiment. If this has not been done, YASARA will add a 'neutralizing plasma' that uniformly pervades the cell.

Example 1:
Longrange None

Do not calculate any long range interactions.


Example 2:
Longrange Coulomb

Calculate electrostatic Coulomb forces without cutoff.