Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

LogAs

-

Log output of next command


CommandArgument DatatypeDefaultMinMax
Format 1:LogAsFilename = Log filename,STRING - --
  append = Yes | NoSTRINGNo--
Format 2: LogAs Filename = Log filename,STRING ---
   append = Yes | No,STRINGNo - -
   AnyOtherCommand STRING---
Python:LogAs(filename,append=None)
LogAs2(filename,append,noname1)
Menu:Options > Log > Next command only
Related:RecordLog, StopLog , RecordMacro
Required:


A log contains the entire output printed to the console.

If you switch the console off, only the output of commands will be printed and recorded.

Use RecordMacro to record just the commands themselves.

As the goal of LogAs is to save the result of a command to a file, it is not allowed assign the result to a variable at the same time.

Example 1:
LogAs MyLog

Save the following output to file log/MyLog.log.


Example 2:
LogAs contactlist,Append=No,ListConAll

Save output of the ListConAll command as log/contactlist.log.


Example 3:
LogAs hbonds.txt,Append=Yes,ListHBoRes 1-30,31-46

Save a list of hydrogen bonds between residues 1-30 and 31-46 (ListHBo) to hbonds.txt, appending to the file if it exists.


Example 4:
LogAs MyLog,append=Yes,Print 'Reached step 10'

Print the text 'Reached step 10' to MyLog, thus using the log as a progress indicator which you can easily check remotely.