Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Local coordinate system - The coordinate system within one object

Because objects can be moved around and rotated independently, every object has its own local coordinate system. The cartesian atom coordinates specified in the PDB file are the same as those in the local coordinate system. (Coordinates shift if you center the object, and the sign of the X-coordinate flips if YASARA uses a left-handed coordinate system).

Sometimes it is desirable to let several objects share the same local coordinate system. There are several ways to achieve that:

  • Load the objects right after each other with the 'Center' option disabled, and don't move the first away before loading the second.
  • Transfer one object to the coordinate system of the other object.
  • Superpose the objects.
  • Join the objects.
  • Transform the coordinate system of all objects, then Center them all together.
  • Start a Simulation to transfer all objects into the coordinate system of the simulation cell.