Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

LoadYOb

-

Load YASARA object


CommandArgument DatatypeDefaultMinMax
Format:LoadYObFilename = Filename of YASARA objectSTRING ---
Python: result = LoadYOb(filename)
Menu:File > Load > YASARA object
Related:LoadPDB, LoadSce , Load*, SaveYOb
Required:


YOB files are flat binary files that can be rapidly processed by YASARA, are 50% smaller than a comparable PDB file and contain specific features like labels or arrows that cannot be stored in normal PDB files. YOB files contain just one object, use SCE files to load/save the entire scene.

If you want the newly loaded object to fall on top of another object, you can easily transfer it.

Example 1:
LoadYOb 1crn

Load the YASARA object 1crn, 1crn.yob or yob/1crn.yob.


Example 2:
obj = LoadYOb 5tim

Load YASARA object 5tim.yob or yob/5tim.yob and assign its number to variable 'obj'.