Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

LoadTbl

-

Load XPLOR distance and dihedral angle restraints


CommandArgument DatatypeDefaultMinMax
Format:LoadTblFilename = Restraint table filename, STRING---
  Object selection, SELECTION---
  Class = Name of restraint class STRING---
Python:LoadTbl(filename,selection1,Class)
Menu:Simulation > Restrain > Distances & Dihedrals
Related:RestrainDis, RestrainDih, RestrainPot , RestrainPar, ScaleRest , ShowRest, HideRest , DelRest, ListRest
Required:and the NMR Structure Determination Module


The LoadTbl command loads a file with NMR restraints in XPLOR format and applies them to the selected object.

If a class name is specified, the restraints can later be modified together using commands that accept a class name, like ScaleRest, ListRest or ShowRest .

Only the XPLOR 'ASSIgn' statement is supported, all other commands are ignored. Distance- and dihedral angle restraints can be mixed freely.

An example for two normal distance restraints (the second with an additional weight), one ambiguous restraint and one dihedral angle restraint is given below:

ASSI (RESI     1 AND NAME  HB2)
     (RESI     1 AND NAME  HE#)      2.852 2.852 0.713

ASSI (RESI     1 AND NAME  HB2)
     (RESI     1 AND NAME  HE#)      2.852 2.852 0.713 weight 2.0

ASSI (RESI     1 AND NAME   HA)
    ((RESI     1 AND NAME  HG1) OR
     (RESI     1 AND NAME  HG2))     3.248 3.248 0.812

ASSI (RESI     2 AND NAME    C)
     (RESI     3 AND NAME    N)
     (RESI     3 AND NAME   CA)
     (RESI     3 AND NAME    C)  1.0  -60.00  30.00  2

For distance restraints, the three numbers on the right are called d, dminus and dplus, they are explained at the RestrainPot command. The optional weight specifies an individual weighting factor per distance restraint.

For dihedral angles restraints, the four numbers are C , Equil, Delta and Exponent, explained at the RestrainDih command.

If you need to use different restraining potentials for subsets of restraints, put each subset into a separate *.tbl file and set the appropriate potential (with the 'update' flag disabled) before loading each file.

Restraints that result from diagonal peaks are ignored , i.e. YASARA simply skips restraints that act within a group of equivalent hydrogens like a methyl or methylene group.

During a simulation, restraints exert a pulling/pushing force, and during an internal coordinate folding run , they are part of the energy function .

The restraints can be shown or hidden on screen and deleted. They are not part of the scene and therefore not affected by undo/redo and not saved with SaveSce. Restraints are deleted automatically when the object they belong to is modified.

Satisfied restraints are drawn green, violated ones red. They can be styled using the PointPar command and the JoinDis option of the RestrainPar command.

Example 1:
LoadTbl noe,linear

Load the XPLOR restraints file noe, noe.tbl or dat/noe.tbl and assign the restraints to the object named 'linear'.


Example 2:
LoadTbl Filename=ambiguous,5,Class=Ambig

Load the restraints file ambiguous, assign the restraints to object have and give them the class name 'Ambig'.