Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

LoadTab

-

Load formatted table


CommandArgument DatatypeDefaultMinMax
Format:LoadTabFilename = Table filename,STRING - --
  Dimensions = Number of table dimensions,INT- 1 3
   Columns = Number of table columns, INT- - -
   Rows = Number of table rows, INT---
   Pages = Number of table pages INT---
Python: result = LoadTab(filename,dimensions,columns,rows,pages)
Menu:Options > Table > Load
Related: Tab , Tabulate, DelTab , SelectTab, MakeTab , ShowTab, SaveTab , FlipTab
Required:


The LoadTab commands imports a table from a text file.

Unless specified explicitly, the table dimensions are read from the file. The file format is recognized automatically and explained below.

  • If a size is specified explicity for each dimension (Columns,Rows,Pages), YASARA creates a fixed size table, fills the cells with the values in the file and raises an error if the numbers do not match. This table can be modified using the Tab command.

  • If a size is specified for all but the last dimension, YASARA creates a growing table and adds cells with the values in the file. This table is automatically selected for use by the Tabulate command. Added cells can also be modified using the Tab command.

Currently the following table formats are supported:

  • Plain text format: Identical to the tables created with SaveTab. The first line is ignored, then the file contains 'Rows' lines with 'Columns' values each. Values are separated by spaces. If the table is three dimensional, the individual 'Pages' are separated by blank lines:


Example of a three-dimensional table with size 8x3x4
240.00 239.00 238.00 237.00 236.00 235.00 234.00 233.00
232.00 231.00 230.00 229.00 228.00 227.00 226.00 225.00
224.00 223.00 222.00 221.00 220.00 219.00 218.00 217.00

216.00 215.00 214.00 213.00 212.00 211.00 210.00 209.00
208.00 207.00 206.00 205.00 204.00 203.00 202.00 201.00
200.00 199.00 198.00 197.00 196.00 195.00 194.00 193.00

192.00 191.00 190.00 189.00 188.00 187.00 186.00 185.00
184.00 183.00 182.00 181.00 180.00 179.00 178.00 177.00
176.00 175.00 174.00 173.00 172.00 171.00 170.00 169.00

168.00 167.00 166.00 165.00 164.00 163.00 162.00 161.00
160.00 159.00 158.00 157.00 156.00 155.00 154.00 153.00
152.00 151.00 150.00 149.00 148.00 147.00 146.00 145.00


Example 1:
LoadTab MyTable

Load the table MyTable, MyTable.tab or dat/MyTable.tab, and obtain the dimensions from the file.


Example 2:
LoadTab MyTable,Dimensions=3,Columns=20,Rows=10,Pages=5

As above, but treat it as a three-dimensional table with a fixed size of 20x10x5 cells. You cannot add any more cells to this table, but you can change table cells .


Example 3:
tab = LoadTab Results,Dimensions=2,Columns=10

Load the table Results.tab or tab/Results.tab and treat it as a two-dimensional growing table with 10 columns. This table is initially filled with the data in 'Results.tab' and then grows indefinitely while you add more cells to it. The table number is assigned to variable 'tab'.