Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

LoadSim

-

Load simulation snapshot in sim format


CommandArgumentDatatypeDefault Min Max
Format: LoadSim Filename = Filename of simulation snapshot, STRING-- -
   assignSec = Yes | NoSTRINGYes - -
Python: LoadSim(filename,assignsec=None)
Menu:File > Load > Simulation snapshot
Related:SaveSim, Sim
Required:


The LoadSim command restores atom velocities, positions, cell dimensions and simulation time (shown in the top right HUD ). Other parameters like force field, cutoff, long range forces and boundary conditions must be set before calling LoadSim and should match the conditions when the snapshot was saved. All the atoms must already be present when calling LoadSim.

If you do not want the simulation to continue after you load a snapshot, pause it before.

The 'assignSec' flag can be used to suppress the reassignment of secondary structure. This is helpful when playing back a simulation to avoid distracting secondary structure changes.

Example 1:
LoadSim 1crn00043

Load atom positions, velocities, simulation time and cell size from 1crn00043, 1crn00043.sim or sim/1crn00043.sim.


Example 2:
LoadSim 1crn00043,assignSec=No

As above, but do not reassign secondary structure.