Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

LoadSce

-

Load complete scene


CommandArgument DatatypeDefaultMinMax
Format:LoadSceFilename = Scene filename,STRING - --
  Settings = Yes | NoSTRING No --
Python:LoadSce(filename,settings=None)
Menu:File > Load > Complete scene
Related: LoadPDB , LoadYOb, Load* , SaveSce
Required:


The LoadSce command loads an entire scene that has been saved before with SaveSce. The scene contains all the objects, as well as general visualization settings like background color that will overwrite the current ones if the Settings parameter is set to 'Yes'.

Note that images do not belong to the scene and must therefore be loaded separately.

The same is true for simulation parameters, which are also not affected by LoadSce. You can create a macro to also restore those.

Example 1:
LoadSce ribosome

Load the scene file ribosome, ribosome.sce or sce/ribosome.sce.


Example 2:
LoadSce ribosome,Settings=Yes

As above, but include all style settings (background colors, lightsource, radii of balls and sticks etc.).