Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

LoadPDB

-

Load Protein Data Bank file


CommandArgument DatatypeDefaultMinMax
Format:LoadPDBFilename = PDB filename,STRING - --
  Center = Yes | No,STRING Yes --
  Correct = Yes | No,STRING Yes --
  Model = Number of model to load INT All--
Python:resultlist = LoadPDB(filename,center=None,correct=None,model=None)
Menu:File > Load > PDB file
Related: LoadYOb , LoadSce, Load*
Required:


The LoadPDB command loads one or more objects in PDB format, each MODEL in the PDB file becomes one object.

If the Center flag is set, the object is shifted so that its mean atom position coincides with the origin of its local coordinate system. This makes sure that rotations with the mouse feel natural. When exporting an object, these transformations can be undone by checking the 'Transform' button.

If the Correct flag is set, YASARA will correct the following problems:
  • Covalent bonds are added to atoms in non-standard residues with missing CONECT records, based on the interatomic distances by calling the Link command.
  • CONECT records that add unusually long bonds are deleted, since these are usually numbering bugs in the PDB file.
  • Cysteines close in space are bridged even if the corresponding CONECT record is missing.
  • The coordinates of methylene, amide and guanidine hydrogens are flipped to match PDB nomenclature.

Many more corrections are performed by the Clean command.

If you want a newly loaded object to fall on top of another object, you have three possibilities:
  • Load the objects right after each other with the 'Center' option disabled.
  • Transfer one object to the coordinate system of the other object.
  • Superpose the objects.

If the PDB file specifies bonds to metal ions in the CONECT section, these will not be treated as true covalent bonds, but will instead be replaced by arrow cylinders. This makes sure that the 'bonds' also survive a simulation, because MD force fields usually treat the interaction with metals purely electrostatically and do not support explicit bonds.

If the PDB file contains standard residues with non-standard atoms , YASARA will treat them like unusual amino acids or nucleotides and retype them . If these non-standard atoms are however dummies that should not form bonds, simply {delete them<Del>}. Alternatively, you can also swap them to true dummies (element 0). Afterwards assign the bonds again.

In case you have the entire PDB installed locally or NFS mounted , the LoadPDB command will automatically try to get the file from there if everything else fails. To enable this feature, you have to click 'File > Load > PDB file from local PDB' and set the PDB path.

Example 1:
LoadPDB 1crn

Load the PDB file 1crn, 1crn.pdb or pdb/1crn.pdb.


Example 2:
LoadPDB 1crn,Center=No

As above, but do not shift the mean atom position to 0/0/0.


Example 3:
obj=LoadPDB 5tim,Correct=No

Load PDB file 5tim.pdb or pdb/5tim.pdb and assign its number to variable 'obj', do not correct potential problems.


Example 4:
objlist()=LoadPDB 1gb1

Load the NMR bundle 1gb1, each model as a separate object, and assign the object numbers to list 'objlist'.


Example 5:
obj=LoadPDB 1gb1,Model=5

Load the 5th model in the NMR bundle 1gb1.