Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

LoadBMP

-

Load image from BMP file


CommandArgument DatatypeDefaultMinMax
Format:LoadBMPFilename = BMP filename,STRING - --
  TransCol = transparent colorRGBCOLOR None--
Python: result = LoadBMP(filename,transcol=None)
Menu:Effects > Image > Load from BMP file
Related:LoadPNG, ShowImage , AutoMoveImage, AnimateImage , SwapImage, HideImage , DelImage, MakeImageObj
Required:


The LoadBMP command loads a bitmap in Windows BMP format for use as background image or texture.

The maximum allowed image size is the same as the maximum OpenGL texture size (usually 2048x2048 pixels).

The image content is not part of the scene and therefore not affected by LoadSce/SaveSce or Undo/Redo. If you attach an image to an object and reload this scene later, you must load the image separately.

Note that YASARA occasionally has to reload the BMP image from disk, so please do not rename or move the file while the image is shown on screen, otherwise the image will appear plain white with the message 'Image not loaded'.

Be careful when using a transparent color : your image must really have a clear separation between the transparent color and the rest. If you use antialised fonts, the pixels at the font edges have colors that are mixtures of the transparent color and the font color, which will show up as an ugly border around the fonts. If antialiased fonts are a must, choose a transparent color that is very close to the actual YASARA background color , then the border will be hardly visible. To avoid all these problems, create an image with a true alpha channel and load it in PNG format.

Example 1:
LoadBMP ysrbkgr1

Load the BMP file ysrbkgr1, ysrbkgr1.bmp or bmp/ysrbkgr1.bmp as a new image.


Example 2:
LoadBMP MyFile,TransCol=Magenta

Load BMP file MyFile.bmp or bmp/MyFile.bmp as a new image and define magenta (RGBCOLOR ff00ff) as the transparent color.


Example 3:
image=LoadBMP MyFile

As above and assign the image number to variable 'image'.